Scientists at IIT Roorkee have achieved a major breakthrough by identifying a potential drug for the treatment of chikungunya ...

Kei Sato was looking for his next big challenge five years ago when it smacked him — and the world — in the face. The ...

Infected mosquitoes spread the chikungunya virus through their bites. The main transmitters are the Aedes aegypti and Aedes albopictus species. The same 2 species of mosquitoes also transmit dengue.

Learn how chikungunya can be prevented. How can chikungunya infections be prevented? If you are planning to travel to an area where chikungunya disease occurs, you should take the proper precautions.

KAUST Catalysis Center (KCC), Division of Physical Sciences and Engineering, King Abdullah University of Science and Technology (KAUST), Thuwal 23955, Kingdom of Saudi Arabia ...

Those who know about the virus but may not be aware of its severity, and those are largely oblivious to chikungunya altogether. While Bavarian Nordic is already seeing demand for Vimkunya start to ...

Background Enterically transmitted hepatitis viruses, such as hepatitis A virus (HAV) and hepatitis E virus (HEV ... Finally, the antiviral countermeasures and in vivo function of HEV genome deletions ...

GTCTAGGATCCATGGTCTAG (located at the 3′ untranslated region of SINV genome). 2.4. Stable SINV-EGFP generation and sequencing SINV-EGFP P0 virus stock was tested by plaque assay, the small and big ...

Experts at BJMC and SGH are sequencing Chikungunya virus to investigate mutations linked to severe cases and outbreaks in Pune. In February this year, experts from B J Medical College (BJMC) and ...

The study, based on samples screened in 2023 and released today, used whole genome ... chikungunya and Zika are also becoming major public health concerns. Although the first human case of Zika ...

To further understand the virus, the icddr,b scientists carried out whole genome sequencing of samples ... they resemble those of dengue and chikungunya, leading to misdiagnosis.